Male Sprague-Dawley rats weighing 200-220 g were divided into three groups. Twelve rats in which diabetes mellitus was not induced were used as controls. Diabetes mellitus was induced by intraperitoneal injection of STZ, 65 mg/kg body weight (Sigma-Aldrich, Saint Louis, MO, USA). Diabetic rats (n = 26) were further randomized into a diabetic control group and a treatment group. Diabetes in the rats was confirmed by a > 300 mg/dL tail blood sugar concentration 48 hours after STZ injection. Rats in the PTX group were treated with 40 mg/kg PTX (Sigma-Aldrich). Fourteen of the rats were sacrificed and the remainder were kept for an additional 4 weeks. Six-hour urine was collected using metabolic cages. Then the rats were anesthetized by intraperitoneal injection of sodium pentobarbital (50 mg/kg). The cortex of one kidney in Trizol reagent (Invitrogen, Carlsbad, CA, USA) was stored at -70℃. The other kidney was perfused with normal saline and fixed in 4% paraformaldehyde.

Body and kidney weights were measured upon sacrifice. Blood glucose levels were determined using standard techniques. Urinary protein was measured with a Pierce BCA Protein Assay Kit (Pierce Biotech Inc., Rockford, IL, USA), and then normalized to urine creatinine measured by the Alkaline Picrate method.

Immortalized normal rat kidney (NRK) cells were acquired from the American Tissue Culture Collection (Rockville, MD, USA). These cells were cultured in DMEM (GibCo BRL, Carlsbad, CA, USA), supplemented with 10% heat-inactivated fetal bovine serum (FBS), 100 U/mL penicillin, and 100 mg/mL streptomycin at 37℃ in a humidified atmosphere of 95% air and 5% CO₂. Then subconfluent cells were cultured in 0.1% FBS for 24 hours before use in experiments. The cells were incubated in 5.5 mM (normal glucose, NG) or 30 mM (high glucose, HG) D-glucose. To induce hypoxia, 100 µM CoCl₂ was administered 6 hours prior. Cells were pretreated with PTX 30 minutes before drug treatment. All experimental groups were cultured in triplicate and harvested at 6 and 24 hours for extraction of total RNA and protein.

Total RNA was extracted from renal cortical tissues or cells with Trizol reagent. Total RNA was reverse transcribed into cDNA using cDNA synthesis (Fermentas, Burlington, Canada) and RNA PCR (Applied Biosystems, Carlsbad, CA, USA) kits in a 20 µL mixture containing 0.5 µg RNA, 50 mM KCl, 50 mM Tris/HCl, 4 mM MgCl₂, 1 mM of each dNTP, oligo-(dT) primers, 20 units of RNAse inhibitor, and 50 units of MuLV reverse transcriptase. The reaction mixture was incubated for 10 minutes at 37℃, 60 minutes at 42℃, and then heated at 90℃ for 5 minutes in a thermocycler (GeneAmp PCR system 2700, Applied Biosystems). RT-PCR was performed using standard three-step cycling conditions with SYBR Green Mastermix. Primers were designed from the respective gene sequences using the Primer 3 software. The nucleotide sequences of each primer were as follows: HIF-1α (sense 5' ACAGCACATTCACAGCTCCCCA, anti-sense 5' TGTGGCTACCATGTACTGCTGGC3'), HO-1 (sense GTGCCCTTGGTAGTCGGCGT, anti-sense CCTCAAAAGACAGCCCTACTTGGTT), vascular endothelial growth factor (VEGF; sense AGCCTTGTTCAGAGCGGAGAA, anti-sense TAACTCAAGCTGCCTCGCCTT), glucose transporter-1 (GLUT-1; sense CAAACTGACAGATCTCGGGC, anti-sense TTCTGGAGCCATCAAAGTCC), glyceraldehyde-3-phosphate dehydrogenase (GAPDH; sense TGCACCACCAACTGCTTAGC, anti-sense 5'-GGCATGGACTGTGGTCATGAG-3'). The expression levels of all genes were normalized to that of the housekeeping gene GAPDH.

For immunohistochemical staining, renal tissue was immediately fixed in 10% neutral buffered formalin, cast in paraffin, and then sliced into 4 µm thick sections. After removal of paraffin in xylene and dehydration in a graded alcohol series, slides were immersed in distilled water. Kidney sections were transferred to a 10 mM citrate buffer solution for antigen retrieval at a pH of 6.0 and then incubated at a sub-boiling temperature for 15 minutes. After washing with water, 3.0% H₂O₂ was applied for 15 minutes to block endogenous peroxidase. To inhibit nonspecific staining, slides were incubated at room temperature for 1 hour with normal goat serum. The primary antibodies mouse monoclonal antihuman HIF-1α (Chemicon, Billerica, MA, USA, 1:500) and rabbit polyclonal anti-rat HO (Abcam, Cambridge, MA, USA, 1:1,000) were added to the slides followed by overnight incubation at 4℃. Negative control sections were stained under identical conditions by substituting the primary antibody with equivalent concentrations of normal rabbit IgG.

Expression was evaluated by semi-quantitatively grading staining within tubules. In this method, each score reflects changes in the extent rather than in the intensity of staining, and depends on the percentage of the grid field that stains positive. Four scores were awarded: 0, absent or < 25% positive staining; 1, 25-50% positive staining; 2, 50-75%; and 3, > 75% positive staining. The average score of each sample was calculated. Each slide was scored by an observer blinded to the experimental details.

Cells were lysed in buffer (150 mM NaCl, 50 mM Tris-HCl, pH 8.0, 1% Triton X-100, 1 mM phenylmethylsulfonylfluoride), and total protein concentrations were quantified using the advanced protein assay reagent (Bio-Rad, Hercules, CA, USA) in a spectrophotometer. An aliquot of 40 µg protein was electrophoresed on 6% or 10% SDS-polyacrylamide gels under denaturing conditions. Then proteins were transferred to polyvinylidene difluoride membranes (Immobilon-P, Millipore, Billerica, MA, USA) for 120 minutes at 250 mA. After blocking in blocking solution (PBS, 0.15% Tween-20, 5% non-fat milk) for 1 hour at room temperature, membranes were hybridized overnight at 4℃ using mouse monoclonal anti-human HIF-1α (Chemicon, 1:500), rabbit polyclonal ant-rat HO-1 (Abcam, 1:1,000), and antirat β-actin (Abcam, 1:3,000). Then the membranes were washed four times with PBS-Tween-20, and incubated for 30 minutes at room temperature with horseradish peroxidase-conjugated secondary antibody, diluted to 1:3,000. Specific signals were detected using the enhanced chemiluminenscence method (Amersham, Buckinghamshire, UK). Equal protein loading was confirmed by β-actin.

We used a nonparametric analysis because most variables were not normally distributed, even after logarithmic transformation. The t test was used to compare groups, and a value of p < 0.05 was defined as statistically significant. All statistical analyses were performed using SPSS version 10.0 (SPSS Inc., Chicago, IL, USA). Data are expressed as mean ± standard derviation.

Blood glucose concentration and kidney weight were significantly higher in STZ-induced diabetic rats than in control rats at 4 and 8 weeks. The increased blood glucose concentration and kidney weight were unaffected by PTX treatment.

The protein creatinine ratio was significantly higher in diabetic rats than in control rats at 4 and 8 weeks. This increased ratio decreased in diabetic rats after PTX treatment at 8 weeks (13.9 ± 4.61 vs. 9.88 ± 1.67 mg/mgCr; p < 0.05) (Table 1).

HIF-1α, VEGF, and GLUT-1 mRNA levels were significantly higher in diabetic rats; that of HO-1 tended to increase in diabetic rats. PTX significantly decreased both HIF-1α and VEGF mRNA expression at 4 and 8 weeks, and decreased that of HO-1 and GLUT-1 at 4 weeks (Fig. 1).

HIF-1α synthesis in the diabetic rat kidney increased at both 4 and 8 weeks. At 8 weeks, its expression was consistently higher than that in control rats. HO-1 expression was not different compared to control rats. These molecules were expressed mainly in the tubules, not in the glomeruli. PTX tended to decrease HIF-1α protein expression by 36% at 8 weeks (Figs. 2 and 3).

To investigate whether PTX directly affected renal tubules, NRK cells were stimulated with CoCl₂ (100 µM), which induced HIF-1α mRNA production under NG conditions. HIF-1α mRNA was also increased under HG conditions. Production was similar even after HG treatment. HG and CoCl₂ showed no synergistic effect on HIF-1α. HIF-1α protein showed a similar pattern. HO-1 mRNA production tended to increase in response to CoCl₂, and protein expression was similar to mRNA expression (Fig. 4).